Rapport de stage technicien








télécharger 210.08 Kb.
titreRapport de stage technicien
page6/8
date de publication07.01.2017
taille210.08 Kb.
typeRapport
b.21-bal.com > documents > Rapport
1   2   3   4   5   6   7   8

Homo sapiens : pas d’homologue




Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MNSLIKRVEKIQKECVDAADKNKQLNADGTTDAFTLLRRKIGLDIKGIRELIKERDEAEASLGPGTVRTVQLSHQVRTAIIDVKGECNKLQRMHDKSEERYKRKNKENPEKQKKLDLTRETCELAWAHVKELELQNKQRGGDGSKFIPRDHNQSSSNASGTKQLPDLDNDDFKELLRNDKQIDGVLDQISEQLKITENIANEMGKAATRQGVLLDTLNDKADVLDEKLENINIRLGKMIKDIRKADRFIIDVILIVVLLGIIGAIVSIVRK

Séquence nucléique des introns :
EL : gtaagttttatttttttttattcctttttttttttattccttttttgtacaacatat taatttttttttatttttttattttttttttttttttttcaaatag
R : gtaattaaaaaatataaaaaaaaaataaaaaaataaaacaaaacaaacatattaatat taatttcttttttnnnnnnnnnnnnnag

g) SNAP 33
Longueur : 461 acides aminés
Point isoélectrique : 7.14
Poids moléculaire : 52335.30

Clones :

Tsukuba : SLJ691 ; SFL355 ; VFI778
Jena : JC1c232h10.r1 ; JC1b203b06.r1 ; JC1b198e09.s1 ; JC1b137g12.s1 ; JC1a66d09.s2 ; JAX4a230c06.r1

Homologues :
Arabidopsis thaliana : SNAP 33 ; SNAP 29 ; SNAP 30
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : KIAA 1533

KIAA 1201

Séquence d’acides aminés : core : 68 aa + 68 aa  ; intron 
MTSPADKANHLKVKTELVRRTFNYPETENVIQDYSCALNKVTLGKMYITENFLSFIASIGSTTETIPLRKILEMKKDTTLFVNNAITFKTAEQLVSFGTFSHRDEAFTLIYHLWKCPPFIYNPNSVDKDLDEKNLFRGAGQQKQKQLSSRVDTQSTKLALKLATETKETGIATLNELSYQAEVIDGIEAKMDNIHANLDRSDRLLKGIESVGGALSNHFSKDTTNGPRKEFAPLDRSLQVRPRDEPPIEIDILEKLANDSLIPGFVQIHNDRFIILDANRKPRTEIISTYTFDSVEYLVIRARPQHMDVRFFNNKYPRFRMASSYIQNVVNEIVLRSNGKYGKAPQVIFEPGIKEFIYGNPTIRFIPSSGRSQQSSLFTRASTLGTSHFIKDASDDIKDALIEQDKDLDEISDLLGDISNIAKTIGDEAERSSSQLDRITDKVDHANDRLKNNNKRIQKML

Séquence nucléique des introns :
MT : gtatggtttggaatattaaaatttttttttatttataattatctttttttttttttt taaaattttttttttttattattcataataataaaactaacaataaaaaataaaaaataaaattaaataaatatatag
TE : gtaaatataataattaataatgaattgatttattagttaattaatttattaattgat ttttatataaaattatacaaatttag


h) VTI 1


  • VTI 1A


Longueur : 217 acides aminés
Point isoélectrique : 9.58
Poids moléculaire : 25139.94

Clones :
Tsukuba : SSG628 ; SSK661
Baylor : IIAFP1D94282


Jena : JC1c227h09

Homologues :
Arabidopsis thaliana : VTI 12

VTI 11 ; VTI 13
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : VTI 1

VTI 2

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MDVFEKTEQNFKHVCNSITKRIKQLPNYGGEKKKIAVKKVENDIDEALKFISEMEKLAQNHPQRIKLQTKTKQYHSDIQKYKREVQLAQLQSSNQTNSNPWSNAPDDYQSQYDNQRQHLLQGSNMLDSTSDRLLRTHQISAQSEQIGQNILMDLGKQGEQIRGMRDKLHETDDQIKSARKIMTGIARRLATNKVILSIIILLLMGIIALIICLKWLR

Séquence nucléique des introns :
QS : gtatgtttatctaaaaatattattattatttttattatttaggtttatgttatataa taaattagctaattatatattatcattttaaatttttaaattttag

  • VTI 1B


Longueur : 217 acides aminés
Point isoélectrique : 9.69
Poids moléculaire : 25600.36

Clones :
Tsukuba : SSE575 ; SSG782 ; SSM133 



Baylor : IICBP1D14311



Homologues :
Arabidopsis thaliana : VTI 12 ; VTI 13
Saccharomyces cerevisiae : VTI 1
Homo sapiens : pas d’homologue

Séquence d’acides aminés : core : 61 aa  ; TM ; intron
MFKVYLNHMKRKLKYPLNNLNKLQQDFQNYYQVCTFKLKQKQPELDKLENLLSTIEGNLSSLNLESNRTGKSTQQYFTQFYGAKRTYQQFRDKYQDEKNYADLIPSQYHDFNTTGSQNQRDRVVRGNKTLENGIQMIRMANDQVREDKKTAESTLEQLATQKERLIGFEKKFDSIDGYLDKAKKTIGQMSRRAMANKFIMAGIIFILLIAIVIQKYK

Séquence nucléique des introns :
K : gtatcctttaaacaatttgaacaaattgcagcaggatttccaaaattattaccaggta tgcccattaaaaggaaaaaaaaaaaaaaaaaaaaaaaaaatttctatttataaacaataactaattaattaatttataattaaaag
V : gtttaatcatttggttgaaattcgttagaactggtgattcaaataataatagtagtag tagtagtttttttgaaactactaccactacctccaccactggtactacttcaacaacttcttctacttccactactactggtactactacttcagatcctgcaactggttcatcaactactaccag

i) NPSN 1


  • NPSN 1A


Longueur : 188 acides aminés
Point isoélectrique : 7.68
Poids moléculaire : 22080.66

Clones :
1   2   3   4   5   6   7   8

similaire:

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage Licence 3

Rapport de stage technicien iconRapport de stage esthetique sommaire

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconRapport de stage
«Sans projet, sans visée à atteindre, la maintenance s’enfonce dans une routine dans des habitudes, dans des acquis difficiles à...

Rapport de stage technicien iconPour les jeunes qui veulent bouger, pour les parents souhaitant trouver...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...








Tous droits réservés. Copyright © 2016
contacts
b.21-bal.com