Rapport de stage technicien








télécharger 210.08 Kb.
titreRapport de stage technicien
page5/8
date de publication07.01.2017
taille210.08 Kb.
typeRapport
b.21-bal.com > documents > Rapport
1   2   3   4   5   6   7   8

Syntaxin 1B ; Syntaxin 2 ; Syntaxin 7 ; Syntaxin 1A




Séquence d’acides aminés : core : 68 aa  ; TM ; introns
MATRDRTPSFNLIKSEYKNRRPSRQEGNESHEKSNNVPLVSLNRAGNNIHNNNNNDLNLQQLNVIPAWMQRVNDIDVNLSKISQQIEKLKGYHDKNLLPDMSMEDQSDLERSIEITTAETTRLFHKTHDMIKNLGGKGTILSAEDMKMKKNIQSSKSAKLQSLSVSFRQKQVTYLKALQKRSNSFSDLYNDQNDDDDGENAIDLDFTDELKQVVNAMEEEITQRDKEIRKIVESINDLTRLFQDISVLVAQQGTILDRIDYNLNQTEAYTQEAVVEIDETNKIHKEYRTRLCILMILVALVDAMVFIFILRFIF

Séquence nucléique des introns :
I : gtaagtaatatattcttcttcttttttttttttattcattcattcatttatttaaaat atttaacctaaaaagataaaattattaacaacaacaacaacaacaacaacaataataatacataataataataataataaatag
RL : gtatttatcaacatattattattaataaaataattaaataataaaaatactaacatt attaatatttttag
d) Syntaxin 5
Longueur : 301 acides aminés
Point isoélectrique : 6.09
Poids moléculaire : 34008.30

Clones :

Tsukuba : SSL871 ; VSI316 ; VFK879 
Baylor : IIAFP1D78028
Jena : JC2b72b06 ; JC2b286g11 ; JC2a166a10 ; JC2b142f10 ; JC2a126d09 
Homologues :
Arabidopsis thaliana : SYP 31

SYP 32
Saccharomyces cerevisiae : SED 5

Homo sapiens : Syntaxin 5A




Séquence d’acides aminés : core : 63 aa  ; TM ; intron



MVFKDRTSEFGNLAETLRRKQEQNGTISHKGKKQHSQKSQFSYAAAEISKGVFETSEKLIKLTNMAKNTKLFMDSSAQIEELTFIIKQDIQKLNKDLSSLDQYVKSSRQPNKQTGDHSETIVGFLNLKLSNATKDFKDILEVRTESLKQQQEKKDSFSGYSNTFSSPPGSSHEHPSGNNNSALYKYEMEDDDNSNEHSILMPQELMMHTTDYSSSRLRAAENISSTINQLEGIFTQLANLVSMQGEVIERIDSMDDSLANISRGHDSLIQTLLNVSSNRSLILKIFLVLIVFIVIFVVFFA

Séquence nucléique des introns :
M : gtaaataattaaataaatacctaaatatttaaatacatacatttcatatatatatata tatatatatatatataaatttcataatttaaggaactaacatctatctatctaatatattgaaatgtag
ES : gtatatattagatatagatttagatttagatttagttatatatattaatctatataa atattattatttatag
N : gtaatgtttcttcttcttcttctaaaagtgatattaggcaccgtaacacaacaaacag agatggttagtgagagagtttattaataattattaattattgtttttgttatttttgtttattattattgttgttgtgtacctctacatccccttccctctctgtctatccaattatcaaaatatcaaaatatcaatatatcaatatcaatatatcaaattcgttcatataaccatcttgtgtttgttgtgttattgtgcttctttttttttttttttttttttttttaactttacaattttaaaactaacttttttttattatttttatttatttttatttattttag

e) Syntaxin 6 ; 8 ; 10


  • Syntaxin 6


Longueur : 255 acides aminés
Point isoélectrique : 6.79
Poids moléculaire : 30633.67

Clones :
Baylor : IICCP1E14993 ; IICCP1E10304


Jena : JC1b148c07

Homologues :
Arabidopsis thaliana : pas d’homologue
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : pas d’homologue

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MSQNIDPFNLMEKSVSESIININKIYNKWYSLLNETNTFSNKKFKFYTKEINRMINDIEIDLNDISNSMKIIENNNNKNEKFKNIPKQEIQRRNEFLKESKNEINNIKIKLSNEEVIKKINSDKLKNQEFNNYNKSNNYTNYIKHQNEIKDTEFLNEQIEYKKSLMDKQDKELDYLLGDVKTIHEISLEIQKELEIQNKILGNLNDRADQSLFSINSVMRQLDRFKENEIFNNIIYYIILLNQTLELSNYNNKTK

Séquence nucléique des introns :
N : gttggtttaaataaattaattttttgtttatttttgtaatattactatttattttttt taaaaaaaattatcaaaaataaattatttattttctaaaaaag

  • Syntaxin 8A


Longueur : 152 acides aminés
Point isoélectrique : 4.92
Poids moléculaire : 17350.33

Clones :

Tsukuba : SSF583 ; SSJ876 ; VSA528
Jena : JC1c10f06

Homologues :
Arabidopsis thaliana : SYP 51 ; SYP 52

SYP 61
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : Syntaxin 8

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MNNNNNFNSNFNSNRISSTQPYLSDDARNALFEGKDRKWGNNNNNNYDTLSNQDVFEKQKRDMEEQDKMLDALSGSISRVKDTAITINKTAQEQTDMLDELDVHVDSTSARMRNTTKNLITLTQQSKTTGYWSVICFLLLVLLVIIILASVL


  • Syntaxin 8B


Longueur : 250 acides aminés
Point isoélectrique : 7.01
Poids moléculaire : 28480.38

Clones :

Tsukuba : SSC269
Baylor : IIAFP1D41684 ; IIAFP1D42462

Homologues :
Arabidopsis thaliana : SYP 51 ; SYP 52
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : Syntaxin 8

Syntaxin 6

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MGDYWLNEHDNIVKLINSLTADIKEYSIQQRNNPGIVQKNTPAKLRNGLVHITNEILRLQDSLTYGNNRNIQEKELLRRKNKVESLISMKNQLNSTLDAAINNTSQKNELMGNNNGVGIGYSNRQFGKPKETEATKQFDNQQLFTNQQHIMREQDESLDLLSQSIMRQKNMAHAMSNELDQHNEMLDDVEIGTDAVSMRLRNANRRMETIKQNAGSTCMIVCIVILIILIVVLIATDSGCKIYNDPKHCP

Séquence nucléique des introns :
I : gtaggttattttcattcattcattcatattcatttcataatagatatctattacctac atcattctcaagattagatcacttttatctttttttttttttttttttttttaatattaatttatttatttataaatcaaaaatcaaatag
K : gtttggattattattattattattaattattattatttatataatattttaatatttt atatattaatattctattattaataataaaataataataaaataaaaaaaaaaaag
D : gtatgtataattttttttttttaaaaaaaaaaaaaaaaaaaacaataaaaaaaaataa caaaaacaccattactaacaaaattttttttattataaaattaaatttag


  • Syntaxin 10


Longueur : 257 acides aminés
Point isoélectrique : 5.60
Poids moléculaire : 29587.91

Clones :

Tsukuba : SSH272 ; VSD227 
Jena : JC2c95a02 ; JAX4d03a07

Homologues :
Arabidopsis thaliana : SYP 61

SYP 51
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : Syntaxin 10 ; Syntaxin 6

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MASPDPDPYFLAEPDIASSVRGIMTTHEKWKQLLFNTNTYTNKEFKWYNKEIRKVLAVIEEDIGDILEAIGTIEKFPGRYVLAPGELDRRKLFANDVKIKINEIKEDLQSPRALAKIEEDKQNELLSSEKRNMIERGGKFEGLRRAHDEDNRDFLREQAGYQRELMNRQDEGLDQMKDDVQILGEMGKAMHSELKIQEGLLDSLHDRAARSSETLGSVMRKLDRFMESTSSKLQWTIIAILGIIFVGLVVLTTMIKK

Séquence nucléique des introns :
P : gttactattttttttttatattttaaaaaaaaaatatatattatatatattatttata tattaatatgtatacatatttacttatataaaatcaaaatatttgtaaaacaaaataaaaaaaaaactttttttttttttttgttttttttttttttggtatatattag

f) SYP 71
Longueur : 271 acides aminés
Point isoélectrique : 8.79
Poids moléculaire : 30695.23

Clones :

Tsukuba : SSH228 ; SSJ567 
Baylor : IIAFP1D70845 
Jena : JC1c108d10 ; JC1c230f08.r1

Homologues :
Arabidopsis thaliana : SYP 72 ; SYP 71 ; SYP 73
Saccharomyces cerevisiae : pas d’homologue

1   2   3   4   5   6   7   8

similaire:

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage Licence 3

Rapport de stage technicien iconRapport de stage esthetique sommaire

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconRapport de stage
«Sans projet, sans visée à atteindre, la maintenance s’enfonce dans une routine dans des habitudes, dans des acquis difficiles à...

Rapport de stage technicien iconPour les jeunes qui veulent bouger, pour les parents souhaitant trouver...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...








Tous droits réservés. Copyright © 2016
contacts
b.21-bal.com