Rapport de stage technicien








télécharger 210.08 Kb.
titreRapport de stage technicien
page4/8
date de publication07.01.2017
taille210.08 Kb.
typeRapport
b.21-bal.com > documents > Rapport
1   2   3   4   5   6   7   8



GOS 28


GOS 12

-

-










MEMBRIN


MEMB 11

MEMB 12


-

GOSR 2

GS27

B- Séquences et propriétés des SNAREs de Dictyostelium discoideum



1°) t-SNAREs
a) Syntaxin 1


  • Syntaxin 1A


Longueur : 344 acides aminés
Point isoélectrique : 5.71
Poids moléculaire : 38627.19

Clones :
Baylor : IIABP1D1011 ; IIAFP1D73332 ; IIBEP1D0288 ; IIACP1D2743


Jena : JC1c259b08 ; JC1b100h06 ; JC1a74e12 ; JC1b168a06 ; JC1a79d05 ; JC1a297h07 ; JC1a43e03 ; JC1a209h01 ; JC1b58h05 ; JC1b169f05 ; JC1c77b11

Homologues :
Arabidopsis thaliana : SYP 124 ; SYP 125 ; SYP 131 ; SYP 123 ; SYP 132 ;

SYP 121 ; SYP 111 ; SYP 122

SYP 112 ; SYP 23 L ; SYP 22 ; SYP 21
Saccharomyces cerevisiae : SSO 2 ; SSO 1

PEP 12 ; TLG 2 ; VAM 3
Homo sapiens : Syntaxin 1A ; Syntaxin 1B ; Syntaxin 2 ; Syntaxin 3

Syntaxin 4A

Séquence d’acides aminés : core : 68 aa  ; TM
MEECLQELRIAGGLKPLVDKKNGKKGSMVEISLETPSSSKIYDYNENKNGDIELEINDHPDPVEEFMPEFYQEVGLIKSLMTSVKKNIRAIEDKYILSLNSISIESQNQKYEDDIQLILEVTNSSLSELKNKLDTMKISNEKYSYSKSSTPTEVRIRNSMLNTLTQKFIEMMREYQEIQNNYKNKYKEKIERQYKIVKPEATSQEINDAIQSGDSKKIFEETILHTHLHTHALNALDYIQERHNDIIKLEQSIKELHQLFLDMAVLVHNQGELLNVIEDNINSAVSDTREGTQNLQEANKLHKKSRKKMYILLIIVSIVLVIILVPILSTQINK


  • Syntaxin 1B


Longueur : 333 acides aminés
Point isoélectrique : 5.35
Poids moléculaire : 38013.12

Clones :

Tsukuba : SLC783

Homologues :
Arabidopsis thaliana : SYP 124 ; SYP 125 ; SYP 132 ; SYP 111 ; SYP 123 ; SYP 121

SYP 122 ; SYP 112
Saccharomyces cerevisiae : SSO 2 ; SSO 1

SED 5
Homo sapiens : Syntaxin 1A ; Syntaxin 1B ; Syntaxin 2 ; Syntaxin 3

Syntaxin 4A

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MEDRLQELRNAGGVKAEVDKKKKGKKGKGGEETPESPSEPSGSNYEDPSINDIELGPDDPEASEEFMPEFYQEVGVLKTLMTSVKRSVRSIEDKYVLSLNSINVDQGSKYEDDIQQMLDGTNKSFSELKKKLDTMKINNDKFAATKTATPTEVRIRSNMHNTLTQKFVEMMREYQEIQNNYKNKYKEKIERQYKIVKPDATQEEIREAIDSGDSKKIFEETILYTHLHTQAKNALDYIQDRHNDILKLEQSIAELHQLFLDMAILVETQGELLNQIEANVESTVLNTKEGVENLAEANRQHKKSRKKMYILLIIVAIVLVAILAPILSTQISK

Séquence nucléique des introns :
K : gtatgtttttttttttttatttatttttttctaattttaaattaattattaaatagta gtattggtcgtagaattagttatagaaatagttgagaaaaaagattagtttgaaatattttataatttctacaattaataacactatgataaatgaatatatagatactaatatattaaatattttaatatctatttatttatctattattttttttatttaaaatatttag
V : gtatgtaaatttatcatcatcatccatcattgaaaatgaaaaaaacaaaagtatacta attaaaataacctttaattttatatgatttatttattag

b) Syntaxin 7


  • Syntaxin 7A


Longueur : 356 acides aminés
Point isoélectrique : 6.25
Poids moléculaire : 40218.95
Clones :

Tsukuba : SLC244 ; SLG670 ; SLH661 ; SLI401 ; SLI511 ; VSH786 ; VSH809 ; SLF713 

Baylor : IIAFP1D26266 ; IIBKP1D1754 


Jena : JAX4a155d06 ; JC1c282g10
Homologues :
Arabidopsis thaliana : SYP 23 L ; SYP 22 ; SYP 21 ; SYP 23 C

SYP 132 ; SYP 124 ; SYP 125 ; SYP 131 ; SYP 123 ; SYP 111 ; SYP 122 ; SYP 121 ; SYP 43 ; SYP 32
Saccharomyces cerevisiae : VAM 3 ; TLG 2 ; PEP 12

SSO 1 ; SED 5 ; SSO 2
Homo sapiens : Syntaxin 12 ; Syntaxin 13 ; Syntaxin 7

Syntaxin 16 ; Syntaxin 4A

Séquence d’acides aminés : core : 68 aa  ; TM ; intron
MYNNNNNFGGGGYNQGGGYNSGGYNNNGGGYNNNNGGYNNNNNNNGGYNNNRPQQQQQQQQQYVNNNNNSFDNNGYGGDDDVTNNSDYQSTTRNIQQIQNAVQILTKLVQLLGTPKDSMDTREKIRNCVDSTTHLISSESGKVKNLTSLASRSRDSKNKLLYQKLVKEFNNCLQQFKDIAQVATKKEKTTPLPVAPDHQQPTTFGRNNNSNNNNQNNHFLNNQQPYYDDDNREDEHQSLMESSRRQQLAQIEAEREYQNSIIQERDEGIRKIEQSIVEINEIFVDLSGLVAEQGVMINTIEASLESTTINTKEGVNHLREASKNQKSSRNKMCWIVLILLIVCAVLGVILFFTLRK

Séquence nucléique des introns :
I : gtatttattaaatttatacaattgcatatacaaaattatcatactaacatatcacttt tttttttttcttctctcttattctcaaaaatttag
NK : gtaagaaataatttagaaattattttatttaaaaataataatactaattgnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntag


  • Syntaxin 7B


Longueur : 286 acides aminés
Point isoélectrique : 5.50
Poids moléculaire : 32718.70

Clones :

Tsukuba : VFJ158 ; VSJ383 ; VFF457 ; VSC683 
Jena : JAX4a193c12.s1 ; JC2c124b04.r1 ; JC2e101d10.r1 ; JC2c119g08.r1

Homologues :
Arabidopsis thaliana : SYP 22 ; SYP 21 ; SYP 23 L

SYP 23 C
Saccharomyces cerevisiae : pas d’homologue
Homo sapiens : pas d’homologue

Séquence d’acides aminés : core : 68 aa  ; TM 
MTDRQPLISKNDDIINNLTRFYTELTEFEKIIKDVGTGRDTTTLRSTLHKKKVNLADDLKVIAQQIKQLPSSKLPKFQQEKIVKQFKEASSKFEELLSTSNKKESSHEPIVPSQQQQQQQNNGNSNNNGYNTRGGYNQQQQQQQQQYNDYTNNNNNNNNNEVEQYNRLEQALKSGIEQDEEEYTNRILDERNANARQIARDVAMLKEAMDDIAVMVGEQGEMLEKVDDNVTNADVAVEDAVVELEKASVYKSSYRKKMIIFVICLLVTLVAVGIFLAIYYGVIKKK

c) Syntaxin 16
Longueur : 314 acides aminés
Point isoélectrique : 5.60
Poids moléculaire : 36445.15

Clones :

Tsukuba : FC-534 ; FC-BN09 ; FC-BP04 ; FC-ICO247 ; VFH511 ; VFC140
Jena : JC2a29c08 ; JC1c19a04 ; JC2a176a10 ; JC2a132h09 ; JAX4b51d04

Homologues :
Arabidopsis thaliana : SYP 41 ; SYP 42 ; SYP 43

SYP 21
Saccharomyces cerevisiae : TLG 2 ; PEP 12

SSO 2
Homo sapiens : Syntaxin 16
1   2   3   4   5   6   7   8

similaire:

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage

Rapport de stage technicien iconRapport de stage Licence 3

Rapport de stage technicien iconRapport de stage esthetique sommaire

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconDécouvrir l’envers du décor d’un tournage et son processus de fabrication...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...

Rapport de stage technicien iconRapport de stage
«Sans projet, sans visée à atteindre, la maintenance s’enfonce dans une routine dans des habitudes, dans des acquis difficiles à...

Rapport de stage technicien iconPour les jeunes qui veulent bouger, pour les parents souhaitant trouver...
«spécial coupe du monde», Roller, Techniques artistiques, Tennis, Vélo-Evolution, Vélo-Mômes, Stage x-trem, Stage "Aventure" pour...








Tous droits réservés. Copyright © 2016
contacts
b.21-bal.com